BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyst039h01
         (498 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AY107093.1| Zea mays PCO127836 mRNA sequence                       137   5e-29
gb|DQ244612.1| Zea mays clone 9624 mRNA sequence                      115   2e-22
ref|NM_001049444.1| Oryza sativa (japonica cultivar-group) Os01g...   109   1e-20
dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...   109   1e-20
dbj|AP002971.2| Oryza sativa (japonica cultivar-group) genomic D...   109   1e-20

>gb|AY107093.1| Zea mays PCO127836 mRNA sequence
          Length = 504

 Score =  137 bits (69), Expect = 5e-29
 Identities = 114/129 (88%)
 Strand = Plus / Plus

                                                                       
Query: 144 ccggccccagaacgtcttcgggtacggtggcttctaccctggcccgacgatcaactgggt 203
           |||||| |||||||| ||||||| ||| ||||||||||| ||||| ||  ||||||||||
Sbjct: 164 ccggccacagaacgtgttcgggttcggcggcttctacccgggccccaccgtcaactgggt 223

                                                                       
Query: 204 ctttccaggcccgaatggcgtcaccccacaggtcggcttcggcgggatgccgggctctag 263
            || || ||||| || ||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 224 gttcccgggccccaacggcgtcaccccgcaggtcggcttcggcgggatgccgggctctag 283

                    
Query: 264 ctccttccc 272
           | |||||||
Sbjct: 284 cgccttccc 292


>gb|DQ244612.1| Zea mays clone 9624 mRNA sequence
          Length = 794

 Score =  115 bits (58), Expect = 2e-22
 Identities = 109/126 (86%)
 Strand = Plus / Plus

                                                                       
Query: 144 ccggccccagaacgtcttcgggtacggtggcttctaccctggcccgacgatcaactgggt 203
           |||||| |||||||| ||||||| ||| ||||||||||| ||||| ||  ||||||||||
Sbjct: 301 ccggccacagaacgtgttcgggttcggcggcttctacccgggccccaccgtcaactgggt 360

                                                                       
Query: 204 ctttccaggcccgaatggcgtcaccccacaggtcggcttcggcgggatgccgggctctag 263
            || || ||||| || ||||||||||| ||| | ||||||||||||||||||||||||||
Sbjct: 361 gttcccgggccccaacggcgtcaccccgcagattggcttcggcgggatgccgggctctag 420

                 
Query: 264 ctcctt 269
           | ||||
Sbjct: 421 cgcctt 426


>ref|NM_001049444.1| Oryza sativa (japonica cultivar-group) Os01g0327500 (Os01g0327500)
           mRNA, complete cds
          Length = 693

 Score =  109 bits (55), Expect = 1e-20
 Identities = 103/119 (86%)
 Strand = Plus / Plus

                                                                       
Query: 142 taccggccccagaacgtcttcgggtacggtggcttctaccctggcccgacgatcaactgg 201
           |||||||| |||||||| | ||| | ||| ||||||||||||||||| |  |||||||||
Sbjct: 211 taccggccgcagaacgtgtacggattcggcggcttctaccctggccccaacatcaactgg 270

                                                                      
Query: 202 gtctttccaggcccgaatggcgtcaccccacaggtcggcttcggcgggatgccgggctc 260
           || || || ||||| || |||||||| || |||||||||||||||||||||||||||||
Sbjct: 271 gtgttccccggccccaacggcgtcacgccgcaggtcggcttcggcgggatgccgggctc 329


>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score =  109 bits (55), Expect = 1e-20
 Identities = 103/119 (86%)
 Strand = Plus / Minus

                                                                            
Query: 142      taccggccccagaacgtcttcgggtacggtggcttctaccctggcccgacgatcaactgg 201
                |||||||| |||||||| | ||| | ||| ||||||||||||||||| |  |||||||||
Sbjct: 12566129 taccggccgcagaacgtgtacggattcggcggcttctaccctggccccaacatcaactgg 12566070

                                                                           
Query: 202      gtctttccaggcccgaatggcgtcaccccacaggtcggcttcggcgggatgccgggctc 260
                || || || ||||| || |||||||| || |||||||||||||||||||||||||||||
Sbjct: 12566069 gtgttccccggccccaacggcgtcacgccgcaggtcggcttcggcgggatgccgggctc 12566011


>dbj|AP002971.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0537A05
          Length = 152396

 Score =  109 bits (55), Expect = 1e-20
 Identities = 103/119 (86%)
 Strand = Plus / Minus

                                                                         
Query: 142   taccggccccagaacgtcttcgggtacggtggcttctaccctggcccgacgatcaactgg 201
             |||||||| |||||||| | ||| | ||| ||||||||||||||||| |  |||||||||
Sbjct: 77739 taccggccgcagaacgtgtacggattcggcggcttctaccctggccccaacatcaactgg 77680

                                                                        
Query: 202   gtctttccaggcccgaatggcgtcaccccacaggtcggcttcggcgggatgccgggctc 260
             || || || ||||| || |||||||| || |||||||||||||||||||||||||||||
Sbjct: 77679 gtgttccccggccccaacggcgtcacgccgcaggtcggcttcggcgggatgccgggctc 77621