BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyst026a02
         (624 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...   226   8e-56
dbj|AP005824.4| Oryza sativa (japonica cultivar-group) genomic D...   226   8e-56
ref|NM_001065838.1| Oryza sativa (japonica cultivar-group) Os07g...   222   1e-54
dbj|AK100914.1| Oryza sativa (japonica cultivar-group) cDNA clon...   222   1e-54
dbj|AK099735.1| Oryza sativa (japonica cultivar-group) cDNA clon...   222   1e-54

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7
          Length = 29644043

 Score =  226 bits (114), Expect = 8e-56
 Identities = 159/174 (91%)
 Strand = Plus / Plus

                                                                           
Query: 23      tgcagtgcaaccgagatccatggacccgttcaaggatctggccgcctacgggtacgggag 82
               ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||
Sbjct: 8529371 tgcagtgcaaccgagatccatggacccgtccaaggatctcgccgcctacgggtacgggag 8529430

                                                                           
Query: 83      cgtggcctggaaggagaggatggagggatggaagcagaagcaggagaggcttcatcagct 142
                ||||| |||||||||||||||||||| |||||||||||||||||| || | || |||||
Sbjct: 8529431 tgtggcatggaaggagaggatggagggctggaagcagaagcaggagcggatgcagcagct 8529490

                                                                     
Query: 143     caggagcaagggcggtggtgattgggatggcgacggtgatgcagatctgccact 196
               ||||||  ||||||| || || |||||||||||||| |||||||||||||||||
Sbjct: 8529491 caggagtgagggcggcggcgactgggatggcgacggcgatgcagatctgccact 8529544



 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                            
Query: 19       gtgctgcagtgcaaccgagatccatggacccgttcaaggatctggccgcctacgggtacg 78
                ||||| |||| ||||| ||||| |||||||| | ||||||||| || || ||||| || |
Sbjct: 13692331 gtgctacagttcaaccaagatctatggacccatccaaggatcttgctgcatacggttatg 13692272

                                                                       
Query: 79       ggagcgtggcctggaaggagaggatggagggatggaagcagaagcaggagaggct 133
                | || || || |||||||||||||||||| | |||||||||||||||||||||||
Sbjct: 13692271 gtagtgttgcgtggaaggagaggatggagagctggaagcagaagcaggagaggct 13692217


>dbj|AP005824.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0669H03
          Length = 167878

 Score =  226 bits (114), Expect = 8e-56
 Identities = 159/174 (91%)
 Strand = Plus / Plus

                                                                         
Query: 23    tgcagtgcaaccgagatccatggacccgttcaaggatctggccgcctacgggtacgggag 82
             ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||
Sbjct: 61839 tgcagtgcaaccgagatccatggacccgtccaaggatctcgccgcctacgggtacgggag 61898

                                                                         
Query: 83    cgtggcctggaaggagaggatggagggatggaagcagaagcaggagaggcttcatcagct 142
              ||||| |||||||||||||||||||| |||||||||||||||||| || | || |||||
Sbjct: 61899 tgtggcatggaaggagaggatggagggctggaagcagaagcaggagcggatgcagcagct 61958

                                                                   
Query: 143   caggagcaagggcggtggtgattgggatggcgacggtgatgcagatctgccact 196
             ||||||  ||||||| || || |||||||||||||| |||||||||||||||||
Sbjct: 61959 caggagtgagggcggcggcgactgggatggcgacggcgatgcagatctgccact 62012


>ref|NM_001065838.1| Oryza sativa (japonica cultivar-group) Os07g0252400 (Os07g0252400)
           mRNA, complete cds
          Length = 3745

 Score =  222 bits (112), Expect = 1e-54
 Identities = 157/172 (91%)
 Strand = Plus / Plus

                                                                       
Query: 27  gtgcaaccgagatccatggacccgttcaaggatctggccgcctacgggtacgggagcgtg 86
           ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |||
Sbjct: 662 gtgcaaccgagatccatggacccgtccaaggatctcgccgcctacgggtacgggagtgtg 721

                                                                       
Query: 87  gcctggaaggagaggatggagggatggaagcagaagcaggagaggcttcatcagctcagg 146
           || |||||||||||||||||||| |||||||||||||||||| || | || |||||||||
Sbjct: 722 gcatggaaggagaggatggagggctggaagcagaagcaggagcggatgcagcagctcagg 781

                                                               
Query: 147 agcaagggcggtggtgattgggatggcgacggtgatgcagatctgccactaa 198
           ||  ||||||| || || |||||||||||||| |||||||||||||||||||
Sbjct: 782 agtgagggcggcggcgactgggatggcgacggcgatgcagatctgccactaa 833


>dbj|AK100914.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133D04, full
           insert sequence
          Length = 3746

 Score =  222 bits (112), Expect = 1e-54
 Identities = 157/172 (91%)
 Strand = Plus / Plus

                                                                       
Query: 27  gtgcaaccgagatccatggacccgttcaaggatctggccgcctacgggtacgggagcgtg 86
           ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |||
Sbjct: 663 gtgcaaccgagatccatggacccgtccaaggatctcgccgcctacgggtacgggagtgtg 722

                                                                       
Query: 87  gcctggaaggagaggatggagggatggaagcagaagcaggagaggcttcatcagctcagg 146
           || |||||||||||||||||||| |||||||||||||||||| || | || |||||||||
Sbjct: 723 gcatggaaggagaggatggagggctggaagcagaagcaggagcggatgcagcagctcagg 782

                                                               
Query: 147 agcaagggcggtggtgattgggatggcgacggtgatgcagatctgccactaa 198
           ||  ||||||| || || |||||||||||||| |||||||||||||||||||
Sbjct: 783 agtgagggcggcggcgactgggatggcgacggcgatgcagatctgccactaa 834


>dbj|AK099735.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013090G16, full
           insert sequence
          Length = 2064

 Score =  222 bits (112), Expect = 1e-54
 Identities = 157/172 (91%)
 Strand = Plus / Plus

                                                                       
Query: 27  gtgcaaccgagatccatggacccgttcaaggatctggccgcctacgggtacgggagcgtg 86
           ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |||
Sbjct: 663 gtgcaaccgagatccatggacccgtccaaggatctcgccgcctacgggtacgggagtgtg 722

                                                                       
Query: 87  gcctggaaggagaggatggagggatggaagcagaagcaggagaggcttcatcagctcagg 146
           || |||||||||||||||||||| |||||||||||||||||| || | || |||||||||
Sbjct: 723 gcatggaaggagaggatggagggctggaagcagaagcaggagcggatgcagcagctcagg 782

                                                               
Query: 147 agcaagggcggtggtgattgggatggcgacggtgatgcagatctgccactaa 198
           ||  ||||||| || || |||||||||||||| |||||||||||||||||||
Sbjct: 783 agtgagggcggcggcgactgggatggcgacggcgatgcagatctgccactaa 834