BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyst024k21
         (765 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

tpg|BK000126.1| TPA_exp: Sorghum bicolor putative phytosulfokine...   115   3e-22
gb|DQ426912.1| Triticum aestivum phytosulfokine-alpha 1 precurso...   101   4e-18
gb|DQ426909.1| Triticum aestivum phytosulfokine-alpha 1 precurso...   101   4e-18
tpg|BK000131.1| TPA_exp: Triticum aestivum putative phytosulfoki...   101   4e-18
tpg|BK000134.1| TPA_exp: Zea mays putative phytosulfokine peptid...    86   2e-13

>tpg|BK000126.1| TPA_exp: Sorghum bicolor putative phytosulfokine peptide precursor
           (PSK1) mRNA, partial cds
          Length = 546

 Score =  115 bits (58), Expect = 3e-22
 Identities = 76/82 (92%)
 Strand = Plus / Plus

                                                                       
Query: 301 acgaggactgcatccagaggaggctgctccacgacgcacacctcgactacatctacactc 360
           ||||| ||||||| |||||| |||||||||||||||| |||||||||||||||||||| |
Sbjct: 213 acgagtactgcatgcagaggcggctgctccacgacgcgcacctcgactacatctacacgc 272

                                 
Query: 361 agcacaagggcaaaccatgagg 382
           ||||||||||||| ||||||||
Sbjct: 273 agcacaagggcaagccatgagg 294


>gb|DQ426912.1| Triticum aestivum phytosulfokine-alpha 1 precursor (PSK1) gene,
           complete cds
          Length = 791

 Score =  101 bits (51), Expect = 4e-18
 Identities = 72/79 (91%)
 Strand = Plus / Plus

                                                                       
Query: 303 gaggactgcatccagaggaggctgctccacgacgcacacctcgactacatctacactcag 362
           ||||| ||||| ||||||||||||||||||||||| ||||| |||||||||||||| |||
Sbjct: 485 gaggagtgcatgcagaggaggctgctccacgacgcgcacctggactacatctacacgcag 544

                              
Query: 363 cacaagggcaaaccatgag 381
           ||||||||||  |||||||
Sbjct: 545 cacaagggcaggccatgag 563


>gb|DQ426909.1| Triticum aestivum phytosulfokine-alpha 1 precursor (PSK1) mRNA,
           complete cds
          Length = 673

 Score =  101 bits (51), Expect = 4e-18
 Identities = 72/79 (91%)
 Strand = Plus / Plus

                                                                       
Query: 303 gaggactgcatccagaggaggctgctccacgacgcacacctcgactacatctacactcag 362
           ||||| ||||| ||||||||||||||||||||||| ||||| |||||||||||||| |||
Sbjct: 367 gaggagtgcatgcagaggaggctgctccacgacgcgcacctggactacatctacacgcag 426

                              
Query: 363 cacaagggcaaaccatgag 381
           ||||||||||  |||||||
Sbjct: 427 cacaagggcaggccatgag 445


>tpg|BK000131.1| TPA_exp: Triticum aestivum putative phytosulfokine peptide
           precursor (PSK1) mRNA, partial cds
          Length = 485

 Score =  101 bits (51), Expect = 4e-18
 Identities = 72/79 (91%)
 Strand = Plus / Plus

                                                                       
Query: 303 gaggactgcatccagaggaggctgctccacgacgcacacctcgactacatctacactcag 362
           ||||| ||||| ||||||||||||||||||||||| ||||| |||||||||||||| |||
Sbjct: 103 gaggagtgcatgcagaggaggctgctccacgacgcgcacctggactacatctacacgcag 162

                              
Query: 363 cacaagggcaaaccatgag 381
           ||||||||||  |||||||
Sbjct: 163 cacaagggcaggccatgag 181


>tpg|BK000134.1| TPA_exp: Zea mays putative phytosulfokine peptide precursor (PSK2)
           mRNA, complete cds
          Length = 778

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 67/75 (89%)
 Strand = Plus / Plus

                                                                       
Query: 309 tgcatccagaggaggctgctccacgacgcacacctcgactacatctacactcagcacaag 368
           ||||| |||||  ||||||||||  |||| |||||||||||||||||||| |||||||||
Sbjct: 421 tgcatgcagagacggctgctccagaacgcgcacctcgactacatctacacacagcacaag 480

                          
Query: 369 ggcaaaccatgagga 383
           ||||| |||||||||
Sbjct: 481 ggcaagccatgagga 495