BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyst016o23
         (450 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|CT828268.1| Oryza sativa (indica cultivar-group) cDNA clone:...   313   3e-82
ref|NM_001074857.1| Oryza sativa (japonica cultivar-group) Os11g...   291   1e-75
gb|DQ245141.1| Zea mays clone 13268 mRNA sequence                     266   7e-68
gb|AF457936.1| Zea mays clone cho1c.pk002.j14, mRNA sequence          266   7e-68
gb|BT017321.1| Zea mays clone EL01N0319C08.c mRNA sequence            250   4e-63

>emb|CT828268.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCFA216P01, full
           insert sequence
          Length = 413

 Score =  313 bits (158), Expect = 3e-82
 Identities = 300/346 (86%), Gaps = 1/346 (0%)
 Strand = Plus / Plus

                                                                       
Query: 99  tccaacgtgtggaactcccaccccaagaactacggccccggctcccgcgtctgccgggtc 158
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 1   tccaacgtgtggaactcccaccccaagaactacgggcccggctcccgcgtctgccgggtc 60

                                                                       
Query: 159 tgtgcgaaccctcacgggctgatcaggaagtatgggctcatgtgctgcaggcaatgcttc 218
           || | ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 61  tgcgggaaccctcatgggctgatcaggaagtatgggctcatgtgctgcaggcagtgcttc 120

                                                                       
Query: 219 cgcagcaacgccaaggatattggcttcatcaagtaccgctgaa-gacattttgccttgct 277
           ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| 
Sbjct: 121 cgcagcaacgccaaggatattggcttcatcaagtaccgctgaaggccattttgccttgcc 180

                                                                       
Query: 278 gctgtggctgagaacttcacctgcatcaaagagttggacccgttaatagaaggcttaatt 337
           | || | ||||||||| | |||| | || |||  |||| |  ||| || ||  ||  |||
Sbjct: 181 gttgagcctgagaactccgcctgaaccagagaaatggatcttttagtataatactacatt 240

                                                                       
Query: 338 tatgtgctttagatttatgttcagagcactgttctagtaaacttgttgaagttttgatgg 397
           |||||| ||||| ||| ||||| ||| || || ||| ||||| |||| ||||||||||||
Sbjct: 241 tatgtggtttagctttttgttcggagtaccgtcctattaaacatgtttaagttttgatgg 300

                                                         
Query: 398 gatgcatgtggtggttgaagtaacttcgtaatgaaagattgaagta 443
           ||  |||| ||| |||||| |||||| || || ||| |||||||||
Sbjct: 301 gaaccatgaggttgttgaactaactttgtgatcaaatattgaagta 346


>ref|NM_001074857.1| Oryza sativa (japonica cultivar-group) Os11g0634500 (Os11g0634500)
           mRNA, complete cds
          Length = 171

 Score =  291 bits (147), Expect = 1e-75
 Identities = 165/171 (96%)
 Strand = Plus / Plus

                                                                       
Query: 90  atgggtcactccaacgtgtggaactcccaccccaagaactacggccccggctcccgcgtc 149
           ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1   atgggccactccaacgtgtggaactcccaccccaagaactacgggcccggctcccgcgtc 60

                                                                       
Query: 150 tgccgggtctgtgcgaaccctcacgggctgatcaggaagtatgggctcatgtgctgcagg 209
           ||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 61  tgccgggtctgcgggaaccctcatgggctgatcaggaagtatgggctcatgtgctgcagg 120

                                                              
Query: 210 caatgcttccgcagcaacgccaaggatattggcttcatcaagtaccgctga 260
           || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 cagtgcttccgcagcaacgccaaggatattggcttcatcaagtaccgctga 171


>gb|DQ245141.1| Zea mays clone 13268 mRNA sequence
          Length = 442

 Score =  266 bits (134), Expect = 7e-68
 Identities = 164/174 (94%)
 Strand = Plus / Plus

                                                                       
Query: 89  gatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggctcccgcgt 148
           |||||| |||||||||||||||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 55  gatggggcactccaacgtgtggaactcgcaccccaagaactacgggcccggatcccgcgt 114

                                                                       
Query: 149 ctgccgggtctgtgcgaaccctcacgggctgatcaggaagtatgggctcatgtgctgcag 208
           |||||||||||||||||||||||| || |||||||||||||| ||||| |||||||||||
Sbjct: 115 ctgccgggtctgtgcgaaccctcatggactgatcaggaagtacgggctgatgtgctgcag 174

                                                                 
Query: 209 gcaatgcttccgcagcaacgccaaggatattggcttcatcaagtaccgctgaag 262
           ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 175 gcagtgcttccgcagcaacgccaaggacattggcttcatcaagtaccgctgaag 228


>gb|AF457936.1| Zea mays clone cho1c.pk002.j14, mRNA sequence
          Length = 402

 Score =  266 bits (134), Expect = 7e-68
 Identities = 164/174 (94%)
 Strand = Plus / Plus

                                                                       
Query: 89  gatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggctcccgcgt 148
           |||||| |||||||||||||||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 28  gatggggcactccaacgtgtggaactcgcaccccaagaactacgggcccggatcccgcgt 87

                                                                       
Query: 149 ctgccgggtctgtgcgaaccctcacgggctgatcaggaagtatgggctcatgtgctgcag 208
           |||||||||||||||||||||||| || |||||||||||||| ||||| |||||||||||
Sbjct: 88  ctgccgggtctgtgcgaaccctcatggactgatcaggaagtacgggctgatgtgctgcag 147

                                                                 
Query: 209 gcaatgcttccgcagcaacgccaaggatattggcttcatcaagtaccgctgaag 262
           ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 148 gcagtgcttccgcagcaacgccaaggacattggcttcatcaagtaccgctgaag 201


>gb|BT017321.1| Zea mays clone EL01N0319C08.c mRNA sequence
          Length = 424

 Score =  250 bits (126), Expect = 4e-63
 Identities = 162/174 (93%)
 Strand = Plus / Plus

                                                                       
Query: 89  gatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggctcccgcgt 148
           |||||| |||||||||||||||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 42  gatggggcactccaacgtgtggaactcgcaccccaagaactacgggcccggatcccgcgt 101

                                                                       
Query: 149 ctgccgggtctgtgcgaaccctcacgggctgatcaggaagtatgggctcatgtgctgcag 208
           |||||||||||||||||||||||| || |||||||||||||| ||| | |||||||||||
Sbjct: 102 ctgccgggtctgtgcgaaccctcatggactgatcaggaagtacggggtgatgtgctgcag 161

                                                                 
Query: 209 gcaatgcttccgcagcaacgccaaggatattggcttcatcaagtaccgctgaag 262
           ||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||
Sbjct: 162 gcagtgcttccgcagcaacgccaaggacattggcttcatcaagtacccctgaag 215