BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyst003c13
         (567 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC091094.2| Felis catus clone RP86-317G18, complete sequence        84   7e-13
emb|CU207318.9| Mouse DNA sequence from clone CH29-612L7 on chro...    80   1e-11
gb|AC163655.3| Mus musculus BAC clone RP23-264P21 from chromosom...    80   1e-11
gb|AC122047.4| Mus musculus BAC clone RP24-456A9 from chromosome...    80   1e-11
gb|AC125539.4| Mus musculus BAC clone RP23-150M18 from 15, compl...    80   1e-11

>gb|AC091094.2| Felis catus clone RP86-317G18, complete sequence
          Length = 134762

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 42/42 (100%)
 Strand = Plus / Minus

                                                      
Query: 26   agagagagagagagagagagagagagagagcaggagagaggc 67
            ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6594 agagagagagagagagagagagagagagagcaggagagaggc 6553


>emb|CU207318.9| Mouse DNA sequence from clone CH29-612L7 on chromosome 6, complete
              sequence
          Length = 219685

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                      
Query: 26     agagagagagagagagagagagagagagagcaggagagag 65
              ||||||||||||||||||||||||||||||||||||||||
Sbjct: 109926 agagagagagagagagagagagagagagagcaggagagag 109887


>gb|AC163655.3| Mus musculus BAC clone RP23-264P21 from chromosome 6, complete sequence
          Length = 185583

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                     
Query: 26    agagagagagagagagagagagagagagagcaggagagag 65
             ||||||||||||||||||||||||||||||||||||||||
Sbjct: 35186 agagagagagagagagagagagagagagagcaggagagag 35147


>gb|AC122047.4| Mus musculus BAC clone RP24-456A9 from chromosome 2, complete sequence
          Length = 172110

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                      
Query: 26     agagagagagagagagagagagagagagagcaggagagag 65
              ||||||||||||||||||||||||||||||||||||||||
Sbjct: 140272 agagagagagagagagagagagagagagagcaggagagag 140311


>gb|AC125539.4| Mus musculus BAC clone RP23-150M18 from 15, complete sequence
          Length = 204453

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                      
Query: 26     agagagagagagagagagagagagagagagcaggagagag 65
              ||||||||||||||||||||||||||||||||||||||||
Sbjct: 112842 agagagagagagagagagagagagagagagcaggagagag 112803