BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphylf030g04
         (1195 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BT009563.1| Triticum aestivum clone wre1n.pk0006.h12:fis, ful...    88   1e-13

>gb|BT009563.1| Triticum aestivum clone wre1n.pk0006.h12:fis, full insert mRNA
           sequence
          Length = 577

 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 62/68 (91%)
 Strand = Plus / Plus

                                                                       
Query: 663 atgttctgtgagggcttctcgccctatggccccttttgggatcactaccttgagtactgg 722
           ||||||||  |||| |||||||||||||||||||| |||||||||| |||||||||||||
Sbjct: 19  atgttctgccaggggttctcgccctatggccccttctgggatcactgccttgagtactgg 78

                   
Query: 723 aaggagag 730
           | ||||||
Sbjct: 79  agggagag 86