BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphylf030c02
         (1223 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|M73232.1|ASTATPASEH Avena sativa vacuolar H+-ATPase 16 kDa pr...   103   2e-18
gb|AY106384.1| Zea mays PCO086002 mRNA sequence                        92   6e-15
gb|DQ245431.1| Zea mays clone 15462 mRNA sequence                      88   1e-13
gb|AY620961.1| Pennisetum glaucum vacuolar ATPase subunit c isof...    88   1e-13
ref|NM_001072387.1| Oryza sativa (japonica cultivar-group) Os11g...    84   2e-12

>gb|M73232.1|ASTATPASEH Avena sativa vacuolar H+-ATPase 16 kDa proteolipid subunit
           (vatp-P1) mRNA, complete cds
          Length = 821

 Score =  103 bits (52), Expect = 2e-18
 Identities = 88/100 (88%)
 Strand = Plus / Plus

                                                                       
Query: 261 gcagcagcaggaacaggaggaagaagataccttcgatgttcagcggcgatgagacggcgc 320
           |||| ||||||  ||||||||| |||||  | ||| ||||||||||||||||||| || |
Sbjct: 102 gcagtagcaggtgcaggaggaacaagatgtcgtcggtgttcagcggcgatgagaccgccc 161

                                                   
Query: 321 cctccttcggcttcctaggcgccgccgcggcgctcgtctt 360
           ||| |||||||||||| |||||||||||||||||||||||
Sbjct: 162 ccttcttcggcttcctcggcgccgccgcggcgctcgtctt 201


>gb|AY106384.1| Zea mays PCO086002 mRNA sequence
          Length = 924

 Score = 91.7 bits (46), Expect = 6e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 299 ttcagcggcgatgagacggcgccctccttcggcttcctaggcgccgccgcggcgctcgtc 358
           ||||||||||| ||||||||||||| |||||||||||| ||||||||||| |||||||||
Sbjct: 188 ttcagcggcgacgagacggcgcccttcttcggcttcctcggcgccgccgccgcgctcgtc 247

             
Query: 359 tt 360
           ||
Sbjct: 248 tt 249


>gb|DQ245431.1| Zea mays clone 15462 mRNA sequence
          Length = 824

 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 59/64 (92%)
 Strand = Plus / Plus

                                                                       
Query: 297 tgttcagcggcgatgagacggcgccctccttcggcttcctaggcgccgccgcggcgctcg 356
           |||||||||||||||||||||| |||| |||||||||||| ||||||||||| || ||||
Sbjct: 51  tgttcagcggcgatgagacggcccccttcttcggcttcctcggcgccgccgccgccctcg 110

               
Query: 357 tctt 360
           ||||
Sbjct: 111 tctt 114


>gb|AY620961.1| Pennisetum glaucum vacuolar ATPase subunit c isoform gene, promoter
            region and complete cds
          Length = 3305

 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 59/64 (92%)
 Strand = Plus / Plus

                                                                        
Query: 297  tgttcagcggcgatgagacggcgccctccttcggcttcctaggcgccgccgcggcgctcg 356
            |||||||||||||||||||||| |||| |||||||||||| ||||||||||| || ||||
Sbjct: 1462 tgttcagcggcgatgagacggcccccttcttcggcttcctcggcgccgccgccgccctcg 1521

                
Query: 357  tctt 360
            ||||
Sbjct: 1522 tctt 1525


>ref|NM_001072387.1| Oryza sativa (japonica cultivar-group) Os11g0169900 (Os11g0169900)
           mRNA, complete cds
          Length = 1025

 Score = 83.8 bits (42), Expect = 2e-12
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 297 tgttcagcggcgatgagacggcgccctccttcggcttcctaggcgccgcc 346
           ||||||||||||||||||||||||||| |||||||||||| |||||||||
Sbjct: 182 tgttcagcggcgatgagacggcgcccttcttcggcttcctcggcgccgcc 231