BLASTN 2.2.17 Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= bphylf029g09 (1179 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 5,422,427 sequences; 20,945,727,253 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value ref|NM_001048662.1| Oryza sativa (japonica cultivar-group) Os01g... 266 2e-67 dbj|AK103756.1| Oryza sativa (japonica cultivar-group) cDNA clon... 266 2e-67 gb|AF159388.1| Phalaris coerulescens thioredoxin-like protein (T... 236 2e-58 gb|AF159389.1|AF159389 Phalaris coerulescens thioredoxin-like pr... 236 2e-58 gb|AF159385.1| Hordeum bulbosum thioredoxin-like protein (Trx) m... 212 2e-51 >ref|NM_001048662.1| Oryza sativa (japonica cultivar-group) Os01g0168200 (Os01g0168200) mRNA, complete cds Length = 938 Score = 266 bits (134), Expect = 2e-67 Identities = 218/246 (88%) Strand = Plus / Plus Query: 164 tgggaaaggaacacactgatgacgaagagaagattgatttcaaaggtggcaatgtgcatg 223 |||||||||||| || |||||| ||||| |||||||| |||||||||||||||||||||| Sbjct: 165 tgggaaaggaacgcagtgatgaagaagacaagattgacttcaaaggtggcaatgtgcatg 224 Query: 224 tcataacaagcaaggagaattgggaccaaaaaattgcagaggcaaacaaggatgggaaaa 283 | || | | ||| |||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 225 tgattagtaacaaagagaattgggaccacaaaattgcagaggcaaacaaggatgggaaaa 284 Query: 284 ttgtggttgcaaattttagtgcttcctggtgtgggccatgccgggtcatttcaccccttt 343 ||||| |||||||||| |||||| | |||||||| |||||||| |||||| |||| | | Sbjct: 285 ttgtgattgcaaatttcagtgctgcatggtgtggaccatgccgtgtcattgcacctgtat 344 Query: 344 atgctgagatgtcacagacatacccccaactcatgttcttgacagtggatgtcgatgagt 403 |||||||||||||||||||||||||||| ||||||||||||| | |||||||| |||| Sbjct: 345 atgctgagatgtcacagacatacccccagttcatgttcttgactatagatgtcgacgagt 404 Query: 404 taatgg 409 |||||| Sbjct: 405 taatgg 410 Score = 178 bits (90), Expect = 3e-41 Identities = 117/126 (92%) Strand = Plus / Plus Query: 812 ggacttcagctcgtcgtgggacatccgagcgaccccgacgttcttcttcctcaagaacgg 871 |||||||||||| || ||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 409 ggacttcagctcatcatgggacatccgagcgacaccgacgttcttcttcctaaagaacgg 468 Query: 872 ggagcaggtggacaagctcgtcggggccaacaaacctgagctcgagaagaaagtggccgc 931 |||||||||||||||||||||||| |||||||| || ||||| ||||||||||||||||| Sbjct: 469 ggagcaggtggacaagctcgtcggcgccaacaagccggagctggagaagaaagtggccgc 528 Query: 932 gattgc 937 | |||| Sbjct: 529 gcttgc 534 >dbj|AK103756.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033143D23, full insert sequence Length = 938 Score = 266 bits (134), Expect = 2e-67 Identities = 218/246 (88%) Strand = Plus / Plus Query: 164 tgggaaaggaacacactgatgacgaagagaagattgatttcaaaggtggcaatgtgcatg 223 |||||||||||| || |||||| ||||| |||||||| |||||||||||||||||||||| Sbjct: 165 tgggaaaggaacgcagtgatgaagaagacaagattgacttcaaaggtggcaatgtgcatg 224 Query: 224 tcataacaagcaaggagaattgggaccaaaaaattgcagaggcaaacaaggatgggaaaa 283 | || | | ||| |||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 225 tgattagtaacaaagagaattgggaccacaaaattgcagaggcaaacaaggatgggaaaa 284 Query: 284 ttgtggttgcaaattttagtgcttcctggtgtgggccatgccgggtcatttcaccccttt 343 ||||| |||||||||| |||||| | |||||||| |||||||| |||||| |||| | | Sbjct: 285 ttgtgattgcaaatttcagtgctgcatggtgtggaccatgccgtgtcattgcacctgtat 344 Query: 344 atgctgagatgtcacagacatacccccaactcatgttcttgacagtggatgtcgatgagt 403 |||||||||||||||||||||||||||| ||||||||||||| | |||||||| |||| Sbjct: 345 atgctgagatgtcacagacatacccccagttcatgttcttgactatagatgtcgacgagt 404 Query: 404 taatgg 409 |||||| Sbjct: 405 taatgg 410 Score = 178 bits (90), Expect = 3e-41 Identities = 117/126 (92%) Strand = Plus / Plus Query: 812 ggacttcagctcgtcgtgggacatccgagcgaccccgacgttcttcttcctcaagaacgg 871 |||||||||||| || ||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 409 ggacttcagctcatcatgggacatccgagcgacaccgacgttcttcttcctaaagaacgg 468 Query: 872 ggagcaggtggacaagctcgtcggggccaacaaacctgagctcgagaagaaagtggccgc 931 |||||||||||||||||||||||| |||||||| || ||||| ||||||||||||||||| Sbjct: 469 ggagcaggtggacaagctcgtcggcgccaacaagccggagctggagaagaaagtggccgc 528 Query: 932 gattgc 937 | |||| Sbjct: 529 gcttgc 534 >gb|AF159388.1| Phalaris coerulescens thioredoxin-like protein (Trx) mRNA, Trx-1 allele, complete cds Length = 978 Score = 236 bits (119), Expect = 2e-58 Identities = 191/215 (88%) Strand = Plus / Plus Query: 187 gaagagaagattgatttcaaaggtggcaatgtgcatgtcataacaagcaaggagaattgg 246 ||||| ||| |||||||||||||||| ||||||||||||||||| | ||| ||| | ||| Sbjct: 619 gaagacaagcttgatttcaaaggtgggaatgtgcatgtcataactaccaaagaggactgg 678 Query: 247 gaccaaaaaattgcagaggcaaacaaggatgggaaaattgtggttgcaaattttagtgct 306 ||||| ||||||||||| ||||||||||||||||||||||| || |||||||| |||||| Sbjct: 679 gaccagaaaattgcagaagcaaacaaggatgggaaaattgttgtggcaaatttcagtgct 738 Query: 307 tcctggtgtgggccatgccgggtcatttcacccctttatgctgagatgtcacagacatac 366 |||||||||||||||||||| |||||| |||| ||||||||||||||||| |||| || Sbjct: 739 tcctggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtcaaagacgtat 798 Query: 367 ccccaactcatgttcttgacagtggatgtcgatga 401 || |||||||||||||||||| | ||||| ||||| Sbjct: 799 cctcaactcatgttcttgacaattgatgttgatga 833 Score = 99.6 bits (50), Expect = 2e-17 Identities = 86/98 (87%) Strand = Plus / Plus Query: 828 tgggacatccgagcgaccccgacgttcttcttcctcaagaacggggagcaggtggacaag 887 ||||||||||| || ||||| |||||||||||||||||||| || ||||| | |||||| Sbjct: 856 tgggacatccgtgcaaccccaacgttcttcttcctcaagaatggccagcagatcgacaag 915 Query: 888 ctcgtcggggccaacaaacctgagctcgagaagaaagt 925 ||||| || |||||||| ||||||||||| |||||||| Sbjct: 916 ctcgttggcgccaacaagcctgagctcgaaaagaaagt 953 >gb|AF159389.1|AF159389 Phalaris coerulescens thioredoxin-like protein (Trx) mRNA, Trx-2 allele, complete cds Length = 975 Score = 236 bits (119), Expect = 2e-58 Identities = 191/215 (88%) Strand = Plus / Plus Query: 187 gaagagaagattgatttcaaaggtggcaatgtgcatgtcataacaagcaaggagaattgg 246 ||||| ||| |||||||||||||||| ||||||||||||||||| | ||| ||| | ||| Sbjct: 616 gaagacaagcttgatttcaaaggtgggaatgtgcatgtcataactaccaaagaggactgg 675 Query: 247 gaccaaaaaattgcagaggcaaacaaggatgggaaaattgtggttgcaaattttagtgct 306 ||||| ||||||||||| ||||||||||||||||||||||| || |||||||| |||||| Sbjct: 676 gaccagaaaattgcagaagcaaacaaggatgggaaaattgttgtggcaaatttcagtgct 735 Query: 307 tcctggtgtgggccatgccgggtcatttcacccctttatgctgagatgtcacagacatac 366 |||||||||||||||||||| |||||| |||| ||||||||||||||||| |||| || Sbjct: 736 tcctggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtcaaagacgtat 795 Query: 367 ccccaactcatgttcttgacagtggatgtcgatga 401 || |||||||||||||||||| | ||||| ||||| Sbjct: 796 cctcaactcatgttcttgacaattgatgttgatga 830 Score = 107 bits (54), Expect = 1e-19 Identities = 87/98 (88%) Strand = Plus / Plus Query: 828 tgggacatccgagcgaccccgacgttcttcttcctcaagaacggggagcaggtggacaag 887 ||||||||||| || ||||| |||||||||||||||||||| || ||||| | |||||| Sbjct: 853 tgggacatccgtgcaaccccaacgttcttcttcctcaagaatggccagcagatcgacaag 912 Query: 888 ctcgtcggggccaacaaacctgagctcgagaagaaagt 925 |||||||| |||||||| ||||||||||| |||||||| Sbjct: 913 ctcgtcggcgccaacaagcctgagctcgaaaagaaagt 950 >gb|AF159385.1| Hordeum bulbosum thioredoxin-like protein (Trx) mRNA, complete cds Length = 1010 Score = 212 bits (107), Expect = 2e-51 Identities = 188/215 (87%) Strand = Plus / Plus Query: 187 gaagagaagattgatttcaaaggtggcaatgtgcatgtcataacaagcaaggagaattgg 246 ||||| ||| |||||||||||||||| |||||||||||||| |||| ||| ||| | ||| Sbjct: 651 gaagataagcttgatttcaaaggtggaaatgtgcatgtcatcacaaccaaagaggactgg 710 Query: 247 gaccaaaaaattgcagaggcaaacaaggatgggaaaattgtggttgcaaattttagtgct 306 |||||||| ||||||| ||||||||||||||||||||||| |||||||| || |||||| Sbjct: 711 gaccaaaaggttgcagaagcaaacaaggatgggaaaattgttgttgcaaacttcagtgct 770 Query: 307 tcctggtgtgggccatgccgggtcatttcacccctttatgctgagatgtcacagacatac 366 || ||||||||||||||||| |||||| |||| |||||||||||||||| |||| || Sbjct: 771 tcgtggtgtgggccatgccgcgtcattgcacctgtttatgctgagatgtccaagacttat 830 Query: 367 ccccaactcatgttcttgacagtggatgtcgatga 401 || |||||||||||||||||| | ||||| ||||| Sbjct: 831 cctcaactcatgttcttgacaattgatgttgatga 865 Score = 117 bits (59), Expect = 1e-22 Identities = 89/99 (89%) Strand = Plus / Plus Query: 828 tgggacatccgagcgaccccgacgttcttcttcctcaagaacggggagcaggtggacaag 887 ||||||||||| || || |||||||| ||||||||||| ||||| ||||| | |||||| Sbjct: 888 tgggacatccgcgcaacgccgacgtttttcttcctcaaaaacggccagcagatcgacaag 947 Query: 888 ctcgtcggggccaacaaacctgagctcgagaagaaagtg 926 |||||||| |||||||||||||||||||||||||||||| Sbjct: 948 ctcgtcggcgccaacaaacctgagctcgagaagaaagtg 986