BLASTN 2.2.17 Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= bphylf002f13 (452 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 5,422,427 sequences; 20,945,727,253 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gb|AY106698.1| Zea mays PCO084914 mRNA sequence 84 5e-13 gb|AY105523.1| Zea mays PCO147002 mRNA sequence 84 5e-13 >gb|AY106698.1| Zea mays PCO084914 mRNA sequence Length = 766 Score = 83.8 bits (42), Expect = 5e-13 Identities = 48/50 (96%) Strand = Plus / Plus Query: 211 acggcaagacggccaaggtgatgcacctcctgctctggggacccaggtga 260 |||||||||||||||||||||||||||| |||||||||||||||| |||| Sbjct: 253 acggcaagacggccaaggtgatgcacctgctgctctggggacccaagtga 302 >gb|AY105523.1| Zea mays PCO147002 mRNA sequence Length = 547 Score = 83.8 bits (42), Expect = 5e-13 Identities = 48/50 (96%) Strand = Plus / Plus Query: 211 acggcaagacggccaaggtgatgcacctcctgctctggggacccaggtga 260 |||||||||||||||||||||||||||| |||||||||||||||| |||| Sbjct: 249 acggcaagacggccaaggtgatgcacctgctgctctggggacccaagtga 298