BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyem209f12
         (2063 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

ref|XM_001394500.1| Aspergillus niger CBS 513.88 hypothetical pr...    92   1e-14
ref|NW_001594247.1| Aspergillus niger CBS 513.88 contig An11c022...    92   1e-14
ref|XM_001257973.1| Neosartorya fischeri NRRL 181 FKBP-type pept...    92   1e-14
ref|XM_745654.1| Aspergillus fumigatus Af293 FKBP-type peptidyl-...    92   1e-14

>ref|XM_001394500.1| Aspergillus niger CBS 513.88 hypothetical protein (An11g05510) mRNA,
            complete cds
          Length = 1422

 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                              
Query: 985  ccccgtatcaccgaggtcgacagcgatgaggaggaggctcccaagctcgt 1034
            |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 790  ccccgtatcaccgaggtcgacagcgaggaggaggaggctcccaagctcgt 839



 Score = 83.8 bits (42), Expect = 3e-12
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1414 atgcgatacattggcaagctgaagaacggcaaggtgtttgattccaacaagaagggcaag 1473
            ||||| ||||| ||||||||  || |||||||||| || ||| |||||||||||||||||
Sbjct: 1174 atgcgctacatcggcaagctcgaggacggcaaggtcttcgatgccaacaagaagggcaag 1233

                                                                        
Query: 1474 ccattcgcgttcaagcttggtgttggccaagtcatcaagggctgggacattggtgtcgct 1533
            || ||| | |||||||| ||    ||| | ||||||||||| |||||||| |||||||| 
Sbjct: 1234 cctttcaccttcaagctcggcaagggcgaggtcatcaagggttgggacatcggtgtcgcc 1293

                  
Query: 1534 ggcatg 1539
            ||||||
Sbjct: 1294 ggcatg 1299


>ref|NW_001594247.1| Aspergillus niger CBS 513.88 contig An11c0220, complete genome
 emb|AM270239.1| Aspergillus niger contig An11c0220, complete genome
          Length = 106607

 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                               
Query: 985   ccccgtatcaccgaggtcgacagcgatgaggaggaggctcccaagctcgt 1034
             |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 11657 ccccgtatcaccgaggtcgacagcgaggaggaggaggctcccaagctcgt 11706


>ref|XM_001257973.1| Neosartorya fischeri NRRL 181 FKBP-type peptidyl-prolyl isomerase,
            putative (NFIA_054230) mRNA, complete cds
          Length = 1440

 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 103/122 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1418 gatacattggcaagctgaagaacggcaaggtgtttgattccaacaagaagggcaagccat 1477
            ||||||| ||||||||  || |||||||||| |||||| ||||||||||||||||||| |
Sbjct: 1196 gatacatcggcaagctcgaggacggcaaggtctttgatgccaacaagaagggcaagcctt 1255

                                                                        
Query: 1478 tcgcgttcaagcttggtgttggccaagtcatcaagggctgggacattggtgtcgctggca 1537
            || | |||||||||||    ||  | ||||||||||||||||| |||||| | |||||||
Sbjct: 1256 tcacattcaagcttggcaagggtgaggtcatcaagggctgggatattggtattgctggca 1315

              
Query: 1538 tg 1539
            ||
Sbjct: 1316 tg 1317


>ref|XM_745654.1| Aspergillus fumigatus Af293 FKBP-type peptidyl-prolyl isomerase,
            putative (AFUA_6G08580) mRNA, complete cds
          Length = 1368

 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 103/122 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1418 gatacattggcaagctgaagaacggcaaggtgtttgattccaacaagaagggcaagccat 1477
            ||||||| ||||||||  || |||||||||| |||||| ||||||||||||||||||| |
Sbjct: 1124 gatacatcggcaagcttgaggacggcaaggtctttgatgccaacaagaagggcaagcctt 1183

                                                                        
Query: 1478 tcgcgttcaagcttggtgttggccaagtcatcaagggctgggacattggtgtcgctggca 1537
            || | |||||||||||    ||  | ||||||||||||||||| |||||| | |||||||
Sbjct: 1184 tcacattcaagcttggcaagggtgaggtcatcaagggctgggatattggtattgctggca 1243

              
Query: 1538 tg 1539
            ||
Sbjct: 1244 tg 1245