BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyem127l02
         (1217 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BT017846.1| Zea mays clone EL01N0510E02.c mRNA sequence             80   2e-11
gb|AY109619.1| Zea mays CL9605_1 mRNA sequence                         80   2e-11

>gb|BT017846.1| Zea mays clone EL01N0510E02.c mRNA sequence
          Length = 1034

 Score = 79.8 bits (40), Expect = 2e-11
 Identities = 100/120 (83%)
 Strand = Plus / Plus

                                                                       
Query: 488 cttctccaactacaacaggcccatattagagacagtcaatactggttatggtcctgcaga 547
           ||||||||||||||||||| ||||| | ||||| ||| | || || ||||| ||||| ||
Sbjct: 382 cttctccaactacaacagggccatagtcgagactgtccaaacgggctatggccctgctga 441

                                                                       
Query: 548 tgtgatctacgccgttctgagcaacggagttcaaggccaggtcactgtgaagcttgctcg 607
            |||||||| ||||| ||||||||||| || ||||||| |||| | || || ||||||||
Sbjct: 442 agtgatctatgccgtcctgagcaacggcgtccaaggccgggtcgccgtcaaacttgctcg 501


>gb|AY109619.1| Zea mays CL9605_1 mRNA sequence
          Length = 1251

 Score = 79.8 bits (40), Expect = 2e-11
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 627 accggcatttttgggagaattgtcgctcgcagcaagctgttcgatgttggctgcgtgctc 686
           |||| |||| ||||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 482 accgccattcttgggaggatcgttgctcgcagcaagctgttcgacgtcggctgcgtgctc 423

                   
Query: 687 ttctacaa 694
           ||||||||
Sbjct: 422 ttctacaa 415