BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyem119k06
         (1155 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

ref|XM_001123151.1| PREDICTED: Apis mellifera similar to protein...   123   2e-24
emb|Z74236.1|SCYDL188C S.cerevisiae chromosome IV reading frame ...    98   1e-16
emb|X83276.1|SCDNAIV S.cerevisiae DNA for ORFs from chromosome IV      98   1e-16
emb|X58857.1|SCPPH22 S.cerevisiae PPH22 gene for protein phospha...    98   1e-16
emb|X56262.1|SCPPH22G Yeast PPH22 gene for protein phosphatase 2A      98   1e-16

>ref|XM_001123151.1| PREDICTED: Apis mellifera similar to protein phosphatase 4
           (formerly X), catalytic subunit (LOC727443), partial
           mRNA
          Length = 597

 Score =  123 bits (62), Expect = 2e-24
 Identities = 269/338 (79%)
 Strand = Plus / Plus

                                                                       
Query: 154 gaagtgaaagctctttgcgccaaagctcgcgaaattttggtagaagaaggcaatgtgcaa 213
           ||||| ||||||||||| || || || || |||||| |  | |||||| | ||||| |||
Sbjct: 95  gaagttaaagctctttgtgcaaaggcacgagaaattcttattgaagaaagtaatgtacaa 154

                                                                       
Query: 214 cgtgttgattctccagtcactgtatgcggtgatattcacggacagttttatgatctcaaa 273
            | |||||||||||||| |||||||| || |||||||| ||||| || |||||| | |||
Sbjct: 155 agagttgattctccagttactgtatgtggagatattcatggacaattctatgatttaaaa 214

                                                                       
Query: 274 gaattatttaaaattggtggagaatgccctgaaacaaactacttgtttttgggagatttt 333
           ||| | |||||  |||| |||||    || || ||||| || |||||  ||||||| |||
Sbjct: 215 gaactctttaaggttggaggagatgtaccagagacaaattatttgttcatgggagacttt 274

                                                                       
Query: 334 gttgatcgtggcttttatagcgttgaaacattcttgctgctattggctttgaaggtccgt 393
           |||||  | || |||||||| |||||||||||| | || || ||||| || ||||| |||
Sbjct: 275 gttgacagaggattttatagtgttgaaacattccttcttcttttggcattaaaggttcgt 334

                                                                       
Query: 394 tatcccgatcgaatcactttaatcagaggcaatcacgagtctcgtcagattacgcaagta 453
           ||||| ||| | || || ||||| ||||| ||||| |||||||| || ||||| ||||| 
Sbjct: 335 tatcctgataggattacattaataagaggaaatcatgagtctcgacaaattacacaagtt 394

                                                 
Query: 454 tatggcttttatgacgaatgtttgcgaaagtatggcag 491
           ||||| || ||||| |||||||| || || ||||||||
Sbjct: 395 tatggtttctatgatgaatgtttacgtaaatatggcag 432


>emb|Z74236.1|SCYDL188C S.cerevisiae chromosome IV reading frame ORF YDL188c
          Length = 1919

 Score = 97.6 bits (49), Expect = 1e-16
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                       
Query: 421 ggcaatcacgagtctcgtcagattacgcaagtatatggcttttatgacgaatgtttgcga 480
           ||||||||||||||| | |||||||| ||||||||||| |||||||||||||||||| ||
Sbjct: 860 ggcaatcacgagtctaggcagattacccaagtatatgggttttatgacgaatgtttgaga 801

                        
Query: 481 aagtatggcagtg 493
           ||||| |||||||
Sbjct: 800 aagtacggcagtg 788


>emb|X83276.1|SCDNAIV S.cerevisiae DNA for ORFs from chromosome IV
          Length = 35383

 Score = 97.6 bits (49), Expect = 1e-16
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                         
Query: 421   ggcaatcacgagtctcgtcagattacgcaagtatatggcttttatgacgaatgtttgcga 480
             ||||||||||||||| | |||||||| ||||||||||| |||||||||||||||||| ||
Sbjct: 23786 ggcaatcacgagtctaggcagattacccaagtatatgggttttatgacgaatgtttgaga 23727

                          
Query: 481   aagtatggcagtg 493
             ||||| |||||||
Sbjct: 23726 aagtacggcagtg 23714


>emb|X58857.1|SCPPH22 S.cerevisiae PPH22 gene for protein phosphatase 2A
          Length = 4177

 Score = 97.6 bits (49), Expect = 1e-16
 Identities = 67/73 (91%)
 Strand = Plus / Plus

                                                                        
Query: 421  ggcaatcacgagtctcgtcagattacgcaagtatatggcttttatgacgaatgtttgcga 480
            ||||||||||||||| | |||||||| ||||||||||| |||||||||||||||||| ||
Sbjct: 2439 ggcaatcacgagtctaggcagattacccaagtatatgggttttatgacgaatgtttgaga 2498

                         
Query: 481  aagtatggcagtg 493
            ||||| |||||||
Sbjct: 2499 aagtacggcagtg 2511


>emb|X56262.1|SCPPH22G Yeast PPH22 gene for protein phosphatase 2A
          Length = 1779

 Score = 97.6 bits (49), Expect = 1e-16
 Identities = 67/73 (91%)
 Strand = Plus / Plus

                                                                       
Query: 421 ggcaatcacgagtctcgtcagattacgcaagtatatggcttttatgacgaatgtttgcga 480
           ||||||||||||||| | |||||||| ||||||||||| |||||||||||||||||| ||
Sbjct: 834 ggcaatcacgagtctaggcagattacccaagtatatgggttttatgacgaatgtttgaga 893

                        
Query: 481 aagtatggcagtg 493
           ||||| |||||||
Sbjct: 894 aagtacggcagtg 906