BLASTN 2.2.17 Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= bphyem115f03 (932 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 5,422,427 sequences; 20,945,727,253 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gb|AF487263.1| Leptosphaeria maculans major facilitator superfam... 363 8e-97 ref|XM_001264649.1| Neosartorya fischeri NRRL 181 eukaryotic tra... 98 8e-17 dbj|AB226075.1| Aspergillus oryzae cDNA, contig sequence: AoEST2932 88 7e-14 dbj|AB223380.1| Aspergillus oryzae cDNA, contig sequence: AoEST0212 88 7e-14 ref|XM_001269146.1| Aspergillus clavatus NRRL 1 eukaryotic trans... 86 3e-13 >gb|AF487263.1| Leptosphaeria maculans major facilitator superfamily (mfs1), elongation factor 1 beta subunit (ef1B), heat shock protein 78 (hsp78), mismatch repair protein 5 (msh5), Zn-II 2Cys6 regulatory protein (znr1), monomodular non-ribosomal peptide synthetase (maa1), putative endo-exoxylanase (xyl38), and protein kinase C (pkc1) genes, complete cds; and unknown gene Length = 38093 Score = 363 bits (183), Expect = 8e-97 Identities = 338/390 (86%), Gaps = 6/390 (1%) Strand = Plus / Minus Query: 133 gctacactccatcgcaggccgacgtcaaggtcttccagcagatcaagcagatccctgctc 192 ||||||| |||||||||||||| || |||||||||||||||||||||||||| ||||| | Sbjct: 4303 gctacaccccatcgcaggccgatgtaaaggtcttccagcagatcaagcagattcctgcac 4244 Query: 193 cagagaagttcccttacgcatggcgctggtacaaccacatcctcacctttgagggcgagt 252 ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||| Sbjct: 4243 cagagaagttcccatacgcatggcgctggtacaaccacatcctcaccttcgagggtgagt 4184 Query: 253 ttgaggccctgcctggcgacccaaccaaggagtacaccgcctatggccctgaggcctctg 312 | ||| | ||||| |||||||||||||||||| |||| ||||| ||||| || |||| | Sbjct: 4183 tcgagtcactgcccggcgacccaaccaaggagcacactgcctacggccccgactcctcgg 4124 Query: 313 agctcaccgtcaaccctgccaaggcacccgagaaggctgctgaggaggaggatgacgacg 372 | ||||| ||||||| ||||||||||| ||||||| ||||| || ||||||||| Sbjct: 4123 aactcacactcaaccccgccaaggcacctgagaaggaggctgaagatgaggatgac---- 4068 Query: 373 aggtcgacctgttcggcagcgacgatgaggaggaggacgcggaggctgagaggataaagg 432 ||||||||||||||||||| ||||| ||||| || ||||| || |||| | | |||| Sbjct: 4067 --atcgacctgttcggcagcgatgatgaagaggaagatgcggaagcggagaaggtcaagg 4010 Query: 433 ccgagcgtctcgctgagtacaacaagaagaaggccggcaaagtaaagcctgctgccaagt 492 |||||||||| || |||||||||||||||||||||||||| || |||||||||||||||| Sbjct: 4009 ccgagcgtcttgccgagtacaacaagaagaaggccggcaaggtcaagcctgctgccaagt 3950 Query: 493 ccattgtcactcttgacgtcaagccttggg 522 |||| ||||| ||||| |||||||| |||| Sbjct: 3949 ccatcgtcacccttgatgtcaagccatggg 3920 Score = 135 bits (68), Expect = 4e-28 Identities = 191/232 (82%) Strand = Plus / Minus Query: 522 gatgacgagacaaacatggacgagcttaaggcccacgttctcagcatcgagaaggacggc 581 |||||||||||||||||||| ||||| |||||| |||||||| ||||||||||||||| Sbjct: 3869 gatgacgagacaaacatggatgagctcaaggccaacgttctcgccatcgagaaggacggt 3810 Query: 582 ctcgtttggggcgcatctgctctgattgctgtcggctacggtatcaagaagcttcaacag 641 ||||| ||||| || || | || | ||||| || | ||||||||||||||| || Sbjct: 3809 ctcgtctggggtgcctcgacactcgtcgctgttggtttcggtatcaagaagctgcagatc 3750 Query: 642 aacttggtcgtcgaggacgagaaggtctccctggatgagttgcagcaagagattgaggca 701 ||||||||| |||| ||||| |||||||| ||||| || ||||| ||| |||||||| Sbjct: 3749 aacttggtcatcgaagacgaaaaggtctcgctggacgacttgcaacaactgattgaggag 3690 Query: 702 ttcgaggaccacgtccagtccaccgacgtggttgctatgcagaagttgtaga 753 ||| |||||||| ||||| ||||| || |||||||||||||||||||||| Sbjct: 3689 gacgaagaccacgttcagtcaaccgatgttgttgctatgcagaagttgtaga 3638 Score = 121 bits (61), Expect = 5e-24 Identities = 79/85 (92%) Strand = Plus / Minus Query: 49 caaacatgggcttcaccgattttgtctctgacgcaggtcttaccctcctgaacaactggg 108 |||| ||||||||||||||||||||||| ||||| || || ||||||||||||||||||| Sbjct: 4644 caaatatgggcttcaccgattttgtctccgacgccggcctcaccctcctgaacaactggg 4585 Query: 109 tcaagactcgcagctacattgttgg 133 ||||||| ||||||||||||||||| Sbjct: 4584 tcaagacgcgcagctacattgttgg 4560 >ref|XM_001264649.1| Neosartorya fischeri NRRL 181 eukaryotic translation elongation factor 1 subunit Eef1-beta, putative (NFIA_014440) mRNA, complete cds Length = 744 Score = 97.6 bits (49), Expect = 8e-17 Identities = 79/89 (88%) Strand = Plus / Plus Query: 444 gctgagtacaacaagaagaaggccggcaaagtaaagcctgctgccaagtccattgtcact 503 ||||||||||| |||||||||| ||||| | ||||||||||||||||||||||| ||| Sbjct: 379 gctgagtacaagaagaagaaggagggcaaggctaagcctgctgccaagtccattgtgact 438 Query: 504 cttgacgtcaagccttgggatgacgagac 532 || || || |||||||||||||||||||| Sbjct: 439 ctcgaggttaagccttgggatgacgagac 467 >dbj|AB226075.1| Aspergillus oryzae cDNA, contig sequence: AoEST2932 Length = 982 Score = 87.7 bits (44), Expect = 7e-14 Identities = 53/56 (94%) Strand = Plus / Plus Query: 477 aagcctgctgccaagtccattgtcactcttgacgtcaagccttgggatgacgagac 532 ||||| ||||||||||||||||||||||| || ||||||||||||||||||||||| Sbjct: 528 aagcccgctgccaagtccattgtcactctcgatgtcaagccttgggatgacgagac 583 >dbj|AB223380.1| Aspergillus oryzae cDNA, contig sequence: AoEST0212 Length = 463 Score = 87.7 bits (44), Expect = 7e-14 Identities = 53/56 (94%) Strand = Plus / Plus Query: 477 aagcctgctgccaagtccattgtcactcttgacgtcaagccttgggatgacgagac 532 ||||| ||||||||||||||||||||||| || ||||||||||||||||||||||| Sbjct: 350 aagcccgctgccaagtccattgtcactctcgatgtcaagccttgggatgacgagac 405 >ref|XM_001269146.1| Aspergillus clavatus NRRL 1 eukaryotic translation elongation factor 1 subunit Eef1-beta, putative (ACLA_024360) mRNA, complete cds Length = 714 Score = 85.7 bits (43), Expect = 3e-13 Identities = 82/95 (86%) Strand = Plus / Plus Query: 438 cgtctcgctgagtacaacaagaagaaggccggcaaagtaaagcctgctgccaagtccatt 497 |||||||||||||||| |||||||||| ||||| || |||||||| |||||||| ||| Sbjct: 376 cgtctcgctgagtacagaaagaagaaggagggcaaggtcaagcctgccgccaagtctatt 435 Query: 498 gtcactcttgacgtcaagccttgggatgacgagac 532 ||||| | || ||||||||||||||||| ||||| Sbjct: 436 gtcaccatggaggtcaagccttgggatgatgagac 470