BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyem110k16
         (1359 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

ref|XM_381624.1| Gibberella zeae PH-1 chromosome 1 hypothetical ...   704   0.0  

>ref|XM_381624.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG01448.1)
            partial mRNA
          Length = 951

 Score =  704 bits (355), Expect = 0.0
 Identities = 739/867 (85%)
 Strand = Plus / Plus

                                                                        
Query: 229  gacggctgatgcgaagaagacgacgataagatatcccttttggtttggcggaagtgccag 288
            |||||| |||||||||||| ||| |||||||||||| |||||||| || |||||||||||
Sbjct: 60   gacggccgatgcgaagaaggcgatgataagatatcctttttggttcggaggaagtgccag 119

                                                                        
Query: 289  tagcatggcagcttgcgttacacatcctttggatcttgtcaaggttcgtcttcaaatgcg 348
            ||| ||||| || |||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 120  tagtatggctgcctgcgttacccatcctttggatctagtcaaggttcgtcttcaaatgcg 179

                                                                        
Query: 349  cacaggcaatgcgcccaagaacatggtcggtacattcgtccacattctccgtcacgatgg 408
            ||| |||||||||||||||||||||||||| || || |||||||| |||||  | || ||
Sbjct: 180  cactggcaatgcgcccaagaacatggtcggcacctttgtccacatcctccgcaatgacgg 239

                                                                        
Query: 409  tcccctcggtctttacagcggcatatccgcctctctcctgcgccagatgacatattcaac 468
             ||||||||||| ||||| || || || |||||  | |||||||||||| | ||||| ||
Sbjct: 240  ccccctcggtctctacagtggtatctcagcctcgttgctgcgccagatgtcgtattctac 299

                                                                        
Query: 469  cgtgcgattcggcgtctacgaagaggtcaagacacgtctcacacgccgtaacgaaggccg 528
            ||| ||||||||||||||||||||| ||||||| ||  | ||||||||||||||||| ||
Sbjct: 300  cgtccgattcggcgtctacgaagagctcaagacgcgcattacacgccgtaacgaaggtcg 359

                                                                        
Query: 529  cgatccatcttttatgacactcgttgccctagccgctggatctggtttcgtaggaggcat 588
             || ||||| |||  ||| ||||||| ||| |||||||| |||||||||||||| |||||
Sbjct: 360  tgacccatcgtttgcgactctcgttggcctcgccgctggctctggtttcgtaggcggcat 419

                                                                        
Query: 589  tgctggaaactttgccgatgttctcaacgtgcgcatgcaacacgatgctgcgcttcctcc 648
            ||||||||||||||||||||| || || ||||||||||| ||||||||||||||||| | 
Sbjct: 420  tgctggaaactttgccgatgtacttaatgtgcgcatgcagcacgatgctgcgcttcccca 479

                                                                        
Query: 649  tgctgagcgccgaaactatcgtcacgcttttgacggcatggtccgtatggcgcgtgagga 708
             || ||||| |||||||| || || || |||||||||||||| || |||||||| || ||
Sbjct: 480  cgccgagcgtcgaaactaccgccatgcgtttgacggcatggttcgcatggcgcgcgaaga 539

                                                                        
Query: 709  ggggcctaagagtatgttccgtggatggttgcccaacagtggccgtgccatgttcatgac 768
             || || ||||| ||||||||||| |||||||| |||||| | |||||||||||||||||
Sbjct: 540  aggacccaagagcatgttccgtggctggttgccaaacagtagtcgtgccatgttcatgac 599

                                                                        
Query: 769  tgctggtcagcttgccagctacgacgtttcaaagagtttgcttctccagtatacgcccat 828
             || ||||| || ||||| |||||  | ||||||||| |||| ||| |||| ||||||||
Sbjct: 600  agccggtcaactcgccagttacgatatctcaaagagtctgctgctcaagtacacgcccat 659

                                                                        
Query: 829  ggaagataacctcaagactcactttacttcttcgttcatcgctggtctggtcgctgctac 888
            ||| |||||||||||||||||||| ||  |||||||||| |||||| | || ||||||||
Sbjct: 660  ggaggataacctcaagactcacttcaccgcttcgttcattgctggttttgttgctgctac 719

                                                                        
Query: 889  tgtaacaagccctatcgacgtcatcaagactcgtgttatgtcttcagcatatgatcacaa 948
              | ||||| ||| | || || ||||||||||| || ||||||||  |  |||| |||  
Sbjct: 720  catcacaagtcctgttgatgttatcaagactcgcgtcatgtcttcgacgcatgaccacgg 779

                                                                        
Query: 949  catcttgcacctgattcgcgacattcaccggactgacggtcttatgtggatgttcaaggg 1008
              |  ||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 780  agttctgcacttgattcgcgacattcaccgaactgacggccttatgtggatgttcaaggg 839

                                                                        
Query: 1009 ctgggttccaagcttcctccgactcggaccacaaaccatttgtacatttgtcttcctaga 1068
            ||||||||| || |||||| |||| ||||| |||||||| || |||||||||||||||||
Sbjct: 840  ctgggttcccagtttcctcagacttggacctcaaaccatctgcacatttgtcttcctaga 899

                                       
Query: 1069 gatgcaccgaaaggcctaccgcaaggt 1095
             |||||||| ||||| |||||||||||
Sbjct: 900  aatgcaccgcaaggcataccgcaaggt 926