BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyem107p12
         (1080 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AY372111.1| Triticum aestivum jasmonate-induced protein mRNA,...    82   5e-12

>gb|AY372111.1| Triticum aestivum jasmonate-induced protein mRNA, complete cds
          Length = 1158

 Score = 81.8 bits (41), Expect = 5e-12
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                       
Query: 620 gaaggtgaatgggctattgttggggggacaggacagtttgctagggcgaccggtgtcatc 679
           |||||||| |||||||||||||| |||||||||||||| |||| ||||| ||||||||||
Sbjct: 382 gaaggtgagtgggctattgttggtgggacaggacagttcgctatggcgatcggtgtcatc 441

                    
Query: 680 accaaaaag 688
             |||||||
Sbjct: 442 tacaaaaag 450