BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyem101f02
         (946 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

ref|NM_077538.3| Caenorhabditis elegans Fourteen-Three-Three fam...   107   8e-20
gb|DQ115331.1| Caenorhabditis remanei 14-3-3 protein (ftt-2) mRN...    98   8e-17
gb|DQ063576.1| Caenorhabditis remanei strain EM464 14-3-3 (ftt-2...    98   8e-17
gb|AY462124.1| Paracoccidioides brasiliensis 14-3-3-like protein...    94   1e-15
gb|EF140724.1| Physarum polycephalum 14-3-3-like protein mRNA, c...    86   3e-13

>ref|NM_077538.3| Caenorhabditis elegans Fourteen-Three-Three family member (ftt-2)
           (ftt-2) mRNA, complete cds
          Length = 1121

 Score =  107 bits (54), Expect = 8e-20
 Identities = 159/194 (81%)
 Strand = Plus / Plus

                                                                       
Query: 547 caacccaccccatccgattgggtcttgctcttaacttctctgttttctactacgaaatta 606
           |||| ||||| |||||  |||| |||||||| ||||||||||| |||| ||| || ||  
Sbjct: 523 caactcacccaatccgcctgggacttgctctcaacttctctgtcttcttctatgagatct 582

                                                                       
Query: 607 tgaacagcccggacaaggcttgccaactcgctaaacaagcttttgatgacgccattgctg 666
           |||||  |||||||||||||||||| || || || || ||||| ||||||||||| ||||
Sbjct: 583 tgaacgccccggacaaggcttgccagcttgccaagcaggctttcgatgacgccatcgctg 642

                                                                       
Query: 667 agctcgacaaccttactgaagactcatacaaggattcgaccgtcattatgcaattgctcc 726
           ||||||||| ||| |  || |||||||||||||| || ||| |||| |||||  | ||||
Sbjct: 643 agctcgacaccctcaacgaggactcatacaaggactctaccctcatcatgcagcttctcc 702

                         
Query: 727 gagataacttgact 740
           | || |||||||||
Sbjct: 703 gtgacaacttgact 716


>gb|DQ115331.1| Caenorhabditis remanei 14-3-3 protein (ftt-2) mRNA, partial cds
          Length = 645

 Score = 97.6 bits (49), Expect = 8e-17
 Identities = 133/161 (82%)
 Strand = Plus / Plus

                                                                       
Query: 558 atccgattgggtcttgctcttaacttctctgttttctactacgaaattatgaacagcccg 617
           ||||| ||||| |||||||| ||||||||||| |||| ||| || ||  |||||   |||
Sbjct: 225 atccgcttgggacttgctctcaacttctctgtcttcttctatgagatcttgaacgctccg 284

                                                                       
Query: 618 gacaaggcttgccaactcgctaaacaagcttttgatgacgccattgctgagctcgacaac 677
           |||||||||||||| ||||| || || || || ||||||||||| ||||||||||||| |
Sbjct: 285 gacaaggcttgccagctcgccaagcaggccttcgatgacgccatcgctgagctcgacacc 344

                                                    
Query: 678 cttactgaagactcatacaaggattcgaccgtcattatgca 718
           || |  || ||||| |||||||| |||||| |||| |||||
Sbjct: 345 ctcaacgaggactcttacaaggactcgaccctcatcatgca 385


>gb|DQ063576.1| Caenorhabditis remanei strain EM464 14-3-3 (ftt-2) mRNA, partial
           cds
          Length = 766

 Score = 97.6 bits (49), Expect = 8e-17
 Identities = 133/161 (82%)
 Strand = Plus / Plus

                                                                       
Query: 558 atccgattgggtcttgctcttaacttctctgttttctactacgaaattatgaacagcccg 617
           ||||| ||||| |||||||| ||||||||||| |||| ||| || ||  |||||   |||
Sbjct: 444 atccgcttgggacttgctctcaacttctctgtcttcttctatgagatcttgaacgctccg 503

                                                                       
Query: 618 gacaaggcttgccaactcgctaaacaagcttttgatgacgccattgctgagctcgacaac 677
           |||||||||||||| ||||| || || || || ||||||||||| ||||||||||||| |
Sbjct: 504 gacaaggcttgccagctcgccaagcaggccttcgatgacgccatcgctgagctcgacacc 563

                                                    
Query: 678 cttactgaagactcatacaaggattcgaccgtcattatgca 718
           || |  || ||||| |||||||| |||||| |||| |||||
Sbjct: 564 ctcaacgaggactcttacaaggactcgaccctcatcatgca 604


>gb|AY462124.1| Paracoccidioides brasiliensis 14-3-3-like protein 2 mRNA, complete
           cds
          Length = 1685

 Score = 93.7 bits (47), Expect = 1e-15
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 549 acccaccccatccgattgggtcttgctcttaacttctctgttttctactacgaaattatg 608
           ||||||||||||||  ||||||||||||| |||||||| || |||||||| |||||  ||
Sbjct: 614 acccaccccatccgtctgggtcttgctctcaacttctccgtcttctactatgaaatcctg 673

                                                                      
Query: 609 aacagcccggacaaggcttgccaactcgctaaacaagcttttgatgacgccattgctga 667
           ||    || ||| |||||||||| ||||| ||||||||||| |||||||| ||||||||
Sbjct: 674 aattctccagaccaggcttgccacctcgccaaacaagctttcgatgacgctattgctga 732


>gb|EF140724.1| Physarum polycephalum 14-3-3-like protein mRNA, complete cds
          Length = 1053

 Score = 85.7 bits (43), Expect = 3e-13
 Identities = 73/83 (87%)
 Strand = Plus / Plus

                                                                       
Query: 168 gttgaggagcgcaacttgctctctgttgcctacaagaacgttgttggtgcccgcagagct 227
           ||||||||||||||| | |||||||||||||||||||||||  ||||||| ||| | || 
Sbjct: 233 gttgaggagcgcaacctcctctctgttgcctacaagaacgtcattggtgctcgccgtgcc 292

                                  
Query: 228 tcttggagaatcatttcctccat 250
           || |||||||||||||| |||||
Sbjct: 293 tcatggagaatcatttcttccat 315