BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyem003o10
         (718 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BT017638.1| Zea mays clone EL01N0438F11.c mRNA sequence            113   1e-21
gb|DQ244216.1| Zea mays clone 3516 mRNA sequence                      105   2e-19
gb|AY106132.1| Zea mays PCO073447 mRNA sequence                        98   6e-17

>gb|BT017638.1| Zea mays clone EL01N0438F11.c mRNA sequence
          Length = 852

 Score =  113 bits (57), Expect = 1e-21
 Identities = 113/131 (86%), Gaps = 3/131 (2%)
 Strand = Plus / Plus

                                                                       
Query: 250 gccgccgcggccgcggaggtgtcgtgggtgccggaccctgtgaccggccactaccgcccg 309
           |||||||| ||||| ||||  ||||||||||| ||||| || || |||||||||||||| 
Sbjct: 265 gccgccgccgccgccgagggctcgtgggtgcccgaccccgtcacgggccactaccgcccc 324

                                                                       
Query: 310 gcgaactgggccgacg---tcgacgccgccgacctccgcgccgcgcacctcacccgcagc 366
           || |||||||||| ||   ||||| |||||||||||||||||||||||||| |||||| |
Sbjct: 325 gccaactgggccgccgccgtcgaccccgccgacctccgcgccgcgcacctcgcccgcacc 384

                      
Query: 367 tacgccagggc 377
           |||||| ||||
Sbjct: 385 tacgcccgggc 395


>gb|DQ244216.1| Zea mays clone 3516 mRNA sequence
          Length = 1063

 Score =  105 bits (53), Expect = 2e-19
 Identities = 112/131 (85%), Gaps = 3/131 (2%)
 Strand = Plus / Plus

                                                                       
Query: 250 gccgccgcggccgcggaggtgtcgtgggtgccggaccctgtgaccggccactaccgcccg 309
           |||||||| ||||| ||||  ||||||||||| || || || || |||||||||||||| 
Sbjct: 286 gccgccgccgccgccgagggctcgtgggtgcccgatcccgtcacgggccactaccgcccc 345

                                                                       
Query: 310 gcgaactgggccgacg---tcgacgccgccgacctccgcgccgcgcacctcacccgcagc 366
           || |||||||||| ||   ||||| |||||||||||||||||||||||||| |||||| |
Sbjct: 346 gccaactgggccgccgccgtcgaccccgccgacctccgcgccgcgcacctcgcccgcacc 405

                      
Query: 367 tacgccagggc 377
           |||||| ||||
Sbjct: 406 tacgcccgggc 416


>gb|AY106132.1| Zea mays PCO073447 mRNA sequence
          Length = 915

 Score = 97.6 bits (49), Expect = 6e-17
 Identities = 111/131 (84%), Gaps = 3/131 (2%)
 Strand = Plus / Plus

                                                                       
Query: 250 gccgccgcggccgcggaggtgtcgtgggtgccggaccctgtgaccggccactaccgcccg 309
           |||||||| || || ||||  ||||||||||| ||||| || || |||||||||||||| 
Sbjct: 266 gccgccgccgctgccgagggctcgtgggtgcccgaccccgtcacgggccactaccgcccc 325

                                                                       
Query: 310 gcgaactgggccgacg---tcgacgccgccgacctccgcgccgcgcacctcacccgcagc 366
           || |||||||||| ||   ||||| ||||||||||||||||||| |||||| |||||| |
Sbjct: 326 gccaactgggccgccgccgtcgaccccgccgacctccgcgccgctcacctcgcccgcacc 385

                      
Query: 367 tacgccagggc 377
           |||||| ||||
Sbjct: 386 tacgcccgggc 396