BLASTN 2.2.17


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= bphyem002b22
         (535 letters)

Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 
           5,422,427 sequences; 20,945,727,253 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AY106698.1| Zea mays PCO084914 mRNA sequence                        84   7e-13
gb|AY105523.1| Zea mays PCO147002 mRNA sequence                        84   7e-13

>gb|AY106698.1| Zea mays PCO084914 mRNA sequence
          Length = 766

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 210 acggcaagacggccaaggtgatgcacctcctgctctggggacccaggtga 259
           |||||||||||||||||||||||||||| |||||||||||||||| ||||
Sbjct: 253 acggcaagacggccaaggtgatgcacctgctgctctggggacccaagtga 302


>gb|AY105523.1| Zea mays PCO147002 mRNA sequence
          Length = 547

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 210 acggcaagacggccaaggtgatgcacctcctgctctggggacccaggtga 259
           |||||||||||||||||||||||||||| |||||||||||||||| ||||
Sbjct: 249 acggcaagacggccaaggtgatgcacctgctgctctggggacccaagtga 298